Fast On‑Site Detection of Rongalite in Food Using an Aptamer‑Based Sandwich Lateral Flow Strip Assay

Background

Rongalite (sodium hydroxymethylsulfinate) is widely employed in industrial dyeing and polymer chemistry as a reducing agent. However, its inadvertent or intentional addition to food items has caused serious health concerns, including formaldehyde release and adverse effects reported in China [5]. Reliable, rapid detection methods are therefore essential to safeguard food safety and public health.

Aptamers—single‑stranded DNA or RNA molecules—offer distinct advantages over antibodies: they are chemically synthesized with high batch consistency, exhibit low immunogenicity, and can be readily modified for diverse sensing platforms [6]. While electrochemical and enzyme‑linked aptamer assays exist for rongalite, they often require complex instrumentation and prolonged analysis times [10]. In contrast, lateral flow strip assays (LFSAs) provide a single‑step, portable, and low‑cost solution suitable for point‑of‑care testing.

To date, only a handful of aptamer‑based chromatographic strip assays have targeted rongalite [13]. Given the growing regulatory scrutiny and the prevalence of illicit additives, we developed a sandwich‑format LFSA that harnesses the specificity of two aptamers and the optical clarity of AuNPs, enabling rapid, on‑site detection of rongalite in diverse food matrices.

Methods

Materials and Reagents

Rongalite was sourced from Tokyo Chemical Industry Co., Ltd. Gold(III) chloride trihydrate (HAuCl₄) and trisodium citrate were purchased from Sigma‑Aldrich (USA). Supporting reagents (NaCl, BSA, sucrose, PEG₂₀₀₀₀, Tween‑20) were obtained from Beijing Biotopped Science and Technology Co., Ltd. Nitrocellulose (NC) membranes (Pall 90, Pall 170, Millipore 135) were supplied by Pall Corporation and Millipore Corporation via Jiening Biotech Company. Food samples—including rice cake (ersi), noodles, tofu, and glucono‑δ‑lactone tofu—were collected from local markets.

Aptamer Preparation via SELEX

The systematic evolution of ligands by exponential enrichment (SELEX) protocol was followed to isolate aptamers with high affinity for rongalite. The initial 82‑mer ssDNA library (5′‑GACATATTCAGTCTGACAGCG‑N₄₀‑GATGGACGAATATCGTCTAGC‑3′) was incubated with rongalite, unbound sequences were washed away, and bound aptamers were amplified by PCR. After 12 enrichment cycles—including counter‑selection against structurally related compounds—clonal sequencing yielded two high‑affinity aptamers: A09 and B09. Their sequences are listed below and were synthesized by Tsingke Biological Technology.

• Primary aptamer A09 (biotin‑labeled): 5′‑Biotin‑GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGCATGCACGGGAGATGGACGAATATCGTCTAGC

• Secondary aptamer B09 (biotin‑labeled): 5′‑Biotin‑GCTAGACGATATTCGTCCATCTCCCGTGCATGCGAGACCGTGAGTTGGACTGACCCGCTTCCGCTGTCAGACTGAATATGTC‑HS‑3′

Production of AuNPs

Gold nanoparticles (~40 nm diameter) were synthesized by citrate reduction of HAuCl₄ following a standard protocol [18]. Size and monodispersity were confirmed by UV/Vis spectroscopy (λ_max ≈ 530 nm) and transmission electron microscopy (TEM) (Fig. 2). The secondary aptamer B09 was conjugated to AuNPs by incubating 1 mL AuNP solution with 4 µL of 100 µM B09, followed by salt‑induced precipitation, centrifugation, and resuspension in 1 mL PBS (pH 7.4) containing 5 % BSA, 5 % sucrose, 1 % PEG₂₀₀₀₀, and 0.05 % Tween‑20.

Lateral Flow Strip Design

The LFSA assembly (Fig. 3) involved a sample pad, gold conjugate pad, NC membrane (Pall 90), and absorbent pad on a backing card. The sample pad was pre‑treated with PBS + 3 % BSA + 0.05 % Tween‑20 and dried at 37 °C for 2 h. The gold conjugate pad received the B09‑AuNPs. The test line on the NC membrane was created by spotting 1 µL biotin‑A09 (10 µM) mixed with 10 µL streptavidin (1 mg mL⁻¹) for 1 h at 4 °C, while the control line consisted of streptavidin alone. After drying, the strip was cut into 40 mm sections and stored overnight at 37 °C.

Specificity Test

Test strips were challenged with 80 µL of 10 µg mL⁻¹ rongalite, formalin, or deionized water. The appearance of a distinct red test line confirmed specificity, whereas the control line remained visible under all conditions.

Dose‑Dependent Test

Rongalite concentrations (0, 0.8, 1, 5, 10 µg mL⁻¹) were prepared in PBS and 80 µL was applied to the sample pad. A visible red line within 15 min defined the detection limit, which was observed at 1 µg mL⁻¹.

Food Sample Test

Five food samples suspected of containing rongalite were extracted (1 g + 10 mL water). After filtration, 80 µL of each extract was tested on the LFSA. Results were cross‑validated by high‑performance liquid chromatography (HPLC).

Results and Discussion

Affinity and Specificity of Aptamers

Non‑linear regression of saturation curves (Fig. 4a) yielded dissociation constants of 61.1 ± 16.4 nM for A09 and 39.8 ± 12.7 nM for B09, confirming strong, specific binding to rongalite (Fig. 4b).

a Binding curves for A09 and B09 (Kd determination). b High‑affinity interaction between aptamers and rongalite.

Assay Performance

The sandwich LFSA produces a red test line when AuNP‑B09 binds rongalite and is captured by immobilized A09. The control line, formed by streptavidin binding excess AuNP‑B09, confirms assay integrity (Fig. 5). Specificity testing against formalin and deionized water produced no false positives, and the detection limit was established at 1 µg mL⁻¹—well below the levels reported in contaminated food samples [5].

Specificity (a) and sensitivity (b) of the LFSA. a 80 µL of 10 µg mL⁻¹ rongalite; b Standard solutions (0–10 µg mL⁻¹) tested.

Food sample analysis confirmed the presence of rongalite in several products, corroborated by HPLC (Table 1). The assay’s robustness was attributed to the optimized buffer (PBS pH 7.4 + 5 % BSA + 5 % sucrose + 1 % PEG₂₀₀₀₀ + 0.05 % Tween‑20) and the selection of Pall 90 NC membrane, which provided optimal flow and minimal non‑specific binding.

Compared with chromatographic methods (GC, HPLC), the LFSA offers comparable sensitivity while eliminating the need for sophisticated instrumentation and extended processing times. Its low cost, single‑step operation, and visual readout make it ideal for on‑site food safety inspections and regulatory compliance.

Conclusions

We have developed a reliable, cost‑effective sandwich‑format LFSA that detects rongalite in food matrices with a limit of 1 µg mL⁻¹. The assay harnesses the specificity of dual aptamers and the optical clarity of AuNPs, enabling immediate, on‑site screening. This platform can play a pivotal role in mitigating food‑borne rongalite contamination and safeguarding public health.

Abbreviations

AuNPs:

Gold nanoparticles

HPLC:

High‑performance liquid chromatography

LFIA:

Lateral flow immunoassay

LFSA:

Lateral flow strip assay

NC membrane:

Nitrocellulose membrane

POCT:

Point‑of‑care testing

SELEX:

Systematic evolution of ligands by exponential enrichment

TEM:

Transmission electron microscopy